PrimePCR™ Variant Mutation Detection Assay: S P681H, SARS-CoV-2

PrimePCR

The PrimePCR SARS-CoV-2 Single Mutation Assay are single-tube mutation detection assays designed to detect specific mutations in the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome. Assays contain unlabeled PCR primers and different dye-labeled, allele-specific probes plus a primer and probe combination for internal positive control.

Info:   Assay differentiates between reference and P681H allele and includes an internal amplification control primer/probe assay.

 
Fluorophore:   FAM,HEX,CY5
List Price:    $889.00
Your Price:   Log In
 

Wet Lab Validated

Assay Information

Technology:   qPCR
Assay Type:   Probe
Application:   Variant Mutation Detection
Unique Assay ID:   qSC2Mut0020194
Amplicon Length:   65
Nucleotide Mutation Detection:   23604C>A
Amino Acid Change:   P681H
MIQE Context :question   GAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTC[C/A]TCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCA

Gene Information

The S gene is a 3822 nucleotide sequence that encodes a glycoprotein responsible for the invasion of host cells. This spike protein consisted of two subunits: S1 contains a receptor-binding domain that binds to ACE2 on the host cell membrane, and S2 mediates fusion between the cell membranes of the virus and the cell. Mutations in either domain of the spike protein may impact the virus’ transmissibility or infectivity.

Gene Symbol:   S
Gene Name:   Surface Glycoprotein
Aliases:   GU280_gp02, spike glycoprotein
RefSeq:   NC_045512.2
Ensembl:   ENSSASG00005000004
Entrez:   43740568

Number Description Download
10039761 PrimePCR™ Assays Quick Guide, Ver B Click to download
10042030 PrimePCR™ PreAmp Assay Quick Guide, Rev A Click to download
10000088666 Instruction Manual, PrimePCR Assays, Panels, and Controls, Ver G Click to download
10000143205 SARS-CoV-2 Variant Detection RT-PCR Assay Protocol Click to download
3226 PIS_PrimePCR SARS-CoV-2 Single and Multiple Mutation Assays Click to download
10000147102 PrimePCR SARS-CoV-2 Multiple Mutation Assay Protocol Click to download